After you sequence a locus from your isolate and compare it with the
sequences in
PAMDB,
you have to carefully check if your sequence is 100% identical over
the entire length with one of the allele sequences in PAMDB.
If your isolate has a sequence that is 100% identical over the entire
length of the locus to one of the alleles already in PAMDB, the blast
result will look like this (note all values highlighted in
bold):
>seq_id|1206 allele=17 locus=L14(kup Yan) []
Length = 1066
Score = 2113 bits (1066), Expect = 0.0
Identities = 1066/1066 (100%)
Strand = Plus / Plus
Query: 1 tactgcgtgccgataaccagggcgagggcggcatcatggcgctgatggccctggcgcggc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 tactgcgtgccgataaccagggcgagggcggcatcatggcgctgatggccctggcgcggc 60
Query: 61 gagcgtcggccaagcatccccggctgcaaatgatgatggtggtgttcggactgttcggcg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 gagcgtcggccaagcatccccggctgcaaatgatgatggtggtgttcggactgttcggcg 120
Query: 121 ccgcattgttctacggtgacagcatgatcacccctgcagtttcggtgttgtcggcgatgg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ccgcattgttctacggtgacagcatgatcacccctgcagtttcggtgttgtcggcgatgg 180
.
.
.
Query: 841 tgatcatgctggtgatcggtttcgagtcgtctggtgcgctggcatccgcctacggcgtgg 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 841 tgatcatgctggtgatcggtttcgagtcgtctggtgcgctggcatccgcctacggcgtgg 900
Query: 961 ggaaatggccaccgctgctggccgtgccgctgttgatctgcctgttgctggtggacggcc 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 961 ggaaatggccaccgctgctggccgtgccgctgttgatctgcctgttgctggtggacggcc 1020
Query: 1021 tgttcttcgccgccaacgtgccgaaaatctttcagggcggggcgtt 1066
||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 tgttcttcgccgccaacgtgccgaaaatctttcagggcggggcgtt 1066
You can see that the length of the locus is 1066 and that the
identities are 1066/1066 (100%) and that the alignment goes from 1 to
1066 and all nucleotides are the same in the query and subject
sequence. Therefore, your isolate has
allele 17 for
locus L14 (kup Yan).
You can now click on "Add/Edit" and then click on "Add allele data to an isolate" and enter the number 17 for the kup (Yan) locus for
your isolate.
Repeat with additional loci
If your sequence is less than 100% identical over the entire length to
any of the allele sequences in PAMDB, your isolate needs to be
assigned a new allele number for the locus you sequenced. In this case
you need to e-mail the PAMDB administrator the raw sequence data of
your sequence (the chromatogram) and if the sequence is considered of
high quality, it will be assigned a new allele number that will be
e-mailed to you. You can then click on "Add/Edit" and then click on
"Add allele data to an isolate" and enter the new assigned number
for the sequenced locus for your isolate.
If you do not have sequence for the entire length of the locus, you
cannot add any allele information for that locus.
You need to obtain a
high quality sequence of the entire length of the locus before you can
add sequence information to your isolate in PAMDB.
